View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5335_high_16 (Length: 308)
Name: NF5335_high_16
Description: NF5335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5335_high_16 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 32210513 - 32210206
Alignment:
| Q |
1 |
aaacctccagcaaccttagcaaaatcaccacctattccaccaatcccacctgatccttcaccttcaggcttagcagcttcatcacttttgggctgatctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32210513 |
aaacctccagcaaccttagcaaaatcaccacctagtccaccaatcccacctgatccttcaccttcaggcttagcagcttcatcacttttgggctgatctg |
32210414 |
T |
 |
| Q |
101 |
caggtttagaagctggtggagtagcagtagtagtgttctcatacttatgcagataatcagcagctttatcaacatatgatccaacacctttctgatcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32210413 |
caggtttagaagctggtggagtagcagtagtagtgttctcatacttatgcagataatcagcagctttatcaacatatgatcctacacctttctgatcatc |
32210314 |
T |
 |
| Q |
201 |
caatttagcatactgaccaactgcatctagaagatcaccagcagcttctgctgtcttgtctttgtctaaatctttcccaaaacctgactgtgctgccttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32210313 |
caatttagcatactgaccaactgcatctagaagatcaccagcagcttctgctgtcttgtctttgtctaaatctttcccaaaacctgactgtgctgcctct |
32210214 |
T |
 |
| Q |
301 |
gcttctac |
308 |
Q |
| |
|
||| |||| |
|
|
| T |
32210213 |
gctactac |
32210206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 147 - 245
Target Start/End: Complemental strand, 32190992 - 32190894
Alignment:
| Q |
147 |
atgcagataatcagcagctttatcaacatatgatccaacacctttctgatcatccaatttagcatactgaccaactgcatctagaagatcaccagcagc |
245 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||| | || |||||||||||||||||||||||||||||||| ||||| |||||||| || ||||| |
|
|
| T |
32190992 |
atgcagataatcagcagccttatcaacatactgtcctaaccccttctgatcatccaatttagcatactgaccaaccgcatcaagaagatctcctgcagc |
32190894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University