View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5335_high_36 (Length: 228)
Name: NF5335_high_36
Description: NF5335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5335_high_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 210
Target Start/End: Complemental strand, 43030739 - 43030549
Alignment:
| Q |
20 |
ataagctgagtggtggcttggaatcatggtgcggtttcttgcaaagtataaggcctactcagatgggattgccacatgatgttggtgagaattctaccat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43030739 |
ataagctgagtggtggcttggaatcatggtgcggtttcttgcaaagtataaggcctactcagatgggattgtcacatgatgttggtgagaattctaccat |
43030640 |
T |
|
| Q |
120 |
atcttcatctttttctaatgagatttttgtctcagccctcctcttattgggggagaagggctttgataatccaaagttaggccgataagta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43030639 |
atcttcatctttttctaatgagatttttgtctcggccctcctcttattgggggagaagggctttgataatccaaagttaggccgataagta |
43030549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 20 - 139
Target Start/End: Original strand, 46527669 - 46527788
Alignment:
| Q |
20 |
ataagctgagtggtggcttggaatcatggtgcggtttcttgcaaagtataaggcctactcagatgggattgccacatgatgttggtgagaattctaccat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| | | | |||||||||||| ||||||||| |
|
|
| T |
46527669 |
ataagctgagtggtggcttggaatcatggagcggtttctatcaaagtataaggcctactcagatgggattatcgcttaatgttggtgagacttctaccat |
46527768 |
T |
|
| Q |
120 |
atcttcatctttttctaatg |
139 |
Q |
| |
|
|||||||| ||||| ||||| |
|
|
| T |
46527769 |
atcttcatatttttttaatg |
46527788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University