View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5335_high_39 (Length: 208)

Name: NF5335_high_39
Description: NF5335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5335_high_39
NF5335_high_39
[»] chr8 (2 HSPs)
chr8 (2-122)||(15755150-15755270)
chr8 (112-208)||(15755312-15755408)
[»] scaffold0294 (2 HSPs)
scaffold0294 (1-96)||(6197-6292)
scaffold0294 (112-208)||(6033-6130)
[»] chr6 (2 HSPs)
chr6 (3-71)||(17117909-17117978)
chr6 (4-47)||(13140166-13140209)


Alignment Details
Target: chr8 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 2 - 122
Target Start/End: Original strand, 15755150 - 15755270
Alignment:
2 cttgagaagagtttgttacgattcagttagcttctgccattgatgcgtgaacttcaagattttcatcttttctcaattcatctcgatttcgtgaagaatg 101  Q
    |||||||||||||||||||||||||||||||||   |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||     
15755150 cttgagaagagtttgttacgattcagttagctttcaccattgatgcgtgaacttcaagcttttcatcttttctcaattcatctcgatttcgtgaagaatc 15755249  T
102 acaccgattattcttcgtttc 122  Q
    ||||||||| |||||||||||    
15755250 acaccgattcttcttcgtttc 15755270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 112 - 208
Target Start/End: Original strand, 15755312 - 15755408
Alignment:
112 ttcttcgtttcactgtttcacgtatcatcgccttcgtctttcttcatgctctattttctcaattttactactgtctgcttcgtcttcatcatgcctc 208  Q
    ||||||||||||| |||||| | ||||||||||||| |||||||||| |||| ||||||||||| ||||||| ||||||||||| ||||||||||||    
15755312 ttcttcgtttcaccgtttcatgcatcatcgccttcggctttcttcatactctgttttctcaattctactactctctgcttcgtcctcatcatgcctc 15755408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0294 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: scaffold0294
Description:

Target: scaffold0294; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 6292 - 6197
Alignment:
1 ccttgagaagagtttgttacgattcagttagcttctgccattgatgcgtgaacttcaagattttcatcttttctcaattcatctcgatttcgtgaa 96  Q
    ||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||||  |||||||  ||||||||||  |||||||||||||||    
6292 ccttgagaagagtttgttacgattcagttagcttccgccattgatgtgtgagcttcaatcttttcatgctttctcaatttctctcgatttcgtgaa 6197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0294; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 112 - 208
Target Start/End: Complemental strand, 6130 - 6033
Alignment:
112 ttcttcgtttcactgtttcacgtatcatcgccttcgtctttcttcatgctctattttctcaattttactac-tgtctgcttcgtcttcatcatgcctc 208  Q
    |||||| |||||| |||||||| ||||||  |||||| ||||||| | |||| ||||||||||| |||||| | ||||||||||| ||||||||||||    
6130 ttcttcttttcaccgtttcacgcatcatctacttcgtttttcttcttcctctgttttctcaattctactacttttctgcttcgtcctcatcatgcctc 6033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 71
Target Start/End: Original strand, 17117909 - 17117978
Alignment:
3 ttgagaagagtttgttacgattcagttagcttctgccattgatgcgtgaacttcaagatt-ttcatcttt 71  Q
    |||||| |||||||||||||||||||||||||| ||||||||||| ||| | ||||| || |||||||||    
17117909 ttgagaggagtttgttacgattcagttagcttccgccattgatgcatgatcctcaagcttcttcatcttt 17117978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 4 - 47
Target Start/End: Complemental strand, 13140209 - 13140166
Alignment:
4 tgagaagagtttgttacgattcagttagcttctgccattgatgc 47  Q
    ||||| |||||  |||||||||||||||||||||||||||||||    
13140209 tgagaggagttacttacgattcagttagcttctgccattgatgc 13140166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University