View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5335_low_22 (Length: 250)
Name: NF5335_low_22
Description: NF5335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5335_low_22 |
 |  |
|
| [»] scaffold1444 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1444 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: scaffold1444
Description:
Target: scaffold1444; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 27 - 232
Target Start/End: Original strand, 209 - 414
Alignment:
| Q |
27 |
aaatcttatgcataactcgtaagagttctatctatctaagttttctaaataaaactagttctaaactaattagaactattggtgagaacataaggttctt |
126 |
Q |
| |
|
|||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
209 |
aaatcttatgcataactcatatgagttttatctatctaagttttctaaataaaactagttctaaactaattagaactattggtgagaacataaggttctt |
308 |
T |
 |
| Q |
127 |
gtgtctttgatgtaaagaaatttctatccttgttagggttgaactaaatttgccaatcacaaagacctatcgtttcacttaaatcttaaaagatactaat |
226 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
309 |
gtgtctttgatgttaagaaatttctatccttgttagggttgaactaaatttgccaatcacaaagacctatcgtttcacttaaatcttaaaagatactaat |
408 |
T |
 |
| Q |
227 |
gaagtt |
232 |
Q |
| |
|
|||||| |
|
|
| T |
409 |
gaagtt |
414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University