View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5335_low_36 (Length: 239)
Name: NF5335_low_36
Description: NF5335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5335_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 1531519 - 1531696
Alignment:
| Q |
16 |
atattgatagttgttgtgcaaaggtgggatgatttggttcaacagatgaaagatataaggaatgttgtggcaaacaagttttttagccaatcaagttatg |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1531519 |
atattcatagttgttgtgcaaaggtgggagaatttggttcaacagatgaaagatataaggaatgttgtggcaaacaagttttttagccaatcaagttatg |
1531618 |
T |
|
| Q |
116 |
cttcttcaagaccttgaagatattcaagttttagttttctagtttatggcagcagtaataggattatgtctttatatt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1531619 |
cttcttcaagaccttgaagatattcaagttttagttttctagtttatggcagcagtaataggattatgtctttatatt |
1531696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 16 - 115
Target Start/End: Complemental strand, 23053703 - 23053606
Alignment:
| Q |
16 |
atattgatagttgttgtgcaaaggtgggatgatttggttcaacagatgaaagatataaggaatgttgtggcaaacaagttttttagccaatcaagttatg |
115 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
23053703 |
atattgacggttgttgtgcaaaggtggaatgatttggttcaacatatgaaagatataaagaatgttgtggcaaacaag--ttttagtcaatcaagttatg |
23053606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 67
Target Start/End: Original strand, 1527118 - 1527160
Alignment:
| Q |
25 |
gttgttgtgcaaaggtgggatgatttggttcaacagatgaaag |
67 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
1527118 |
gttgttgtgcagaggtgggatgatttggttcatcagatgaaag |
1527160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University