View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5336_low_12 (Length: 246)
Name: NF5336_low_12
Description: NF5336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5336_low_12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 246
Target Start/End: Complemental strand, 25011706 - 25011471
Alignment:
| Q |
12 |
atcaagatgcacacaggcagaggatcgttgactggatcagtgctgctggtggtactgcaggtgcatttgatgttacaaccaaagggattcttcactctgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011706 |
atcaagatgcacacaggcagaggatcgttgactggatcagtgctgctggtggtactgcaggtgcatttgatgttacaaccaaagggattcttcactctgt |
25011607 |
T |
|
| Q |
112 |
gagtactcaacttgacggtttcaataatttctcttcaaacttactcttcaatcctgtggaattcttcgaatagtgtatagcacttacacgaaacgataat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25011606 |
gagtactcaacttgacggtttcaataatttctcttcaaacttactcttcaatcctgtggaattcttcgaatagtgtatagcactttttcgaaacgataat |
25011507 |
T |
|
| Q |
212 |
ttgacaaagcaacgtg-tttcagatatactagtttc |
246 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25011506 |
ttgacaaagcaacgtgttttcagatatactagtttc |
25011471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University