View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5337-Insertion-1 (Length: 285)
Name: NF5337-Insertion-1
Description: NF5337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5337-Insertion-1 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 154 - 285
Target Start/End: Original strand, 29413093 - 29413224
Alignment:
| Q |
154 |
ttatgcaggcaggggagaggtagggcagttaggttgaccaaaaaaggtgtctgatttcatcacaacaatgcatacatctacaagaaaactactacttttg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29413093 |
ttatgcaggcaggggagaggtagggcagttaggttgaccaaaaaaggtgtctgatttcatcacaacaatgcatacatctacaagaaaactactacttttg |
29413192 |
T |
|
| Q |
254 |
ggaagaaagnnnnnnnctaaaagtttcacagt |
285 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
29413193 |
ggaagaaagaaaaaaactaaaagtttcacagt |
29413224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 7 - 110
Target Start/End: Original strand, 29412946 - 29413049
Alignment:
| Q |
7 |
acaacctcccagtcattactgcgagaagacttttccccttcatcttcagttcctgccatctttcgtcttcatcaaaaagttgatatcagagttctaattt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29412946 |
acaacctcccagtcattactgcgagaagacttttccccttcatcttcagttcctgccatcttttgtcttcatcaaaaagttgatatcagagttctaattt |
29413045 |
T |
|
| Q |
107 |
tact |
110 |
Q |
| |
|
|||| |
|
|
| T |
29413046 |
tact |
29413049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 154 - 285
Target Start/End: Complemental strand, 10161080 - 10160949
Alignment:
| Q |
154 |
ttatgcaggcaggggagaggtagggcagttaggttgaccaaaaaaggtgtctgatttcatcacaacaatgcatacatctacaagaaaactactacttttg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10161080 |
ttatgcaggcaggggagaggtagggcagttaggttgatcaaaaaaggtgttcgatttcatcacaacaatgcatacatctacgagaaaactactacttttg |
10160981 |
T |
|
| Q |
254 |
ggaagaaagnnnnnnnctaaaagtttcacagt |
285 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
10160980 |
ggaagaaagaaaaaaactaaaagtttcacagt |
10160949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 7 - 110
Target Start/End: Complemental strand, 10161233 - 10161130
Alignment:
| Q |
7 |
acaacctcccagtcattactgcgagaagacttttccccttcatcttcagttcctgccatctttcgtcttcatcaaaaagttgatatcagagttctaattt |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10161233 |
acaacctcccagtcattaccgcgagaagacttgtccccttcattttcagttcctgccatcttttgtcttcatcaaaaagttgctatcagagttctaattt |
10161134 |
T |
|
| Q |
107 |
tact |
110 |
Q |
| |
|
|||| |
|
|
| T |
10161133 |
tact |
10161130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University