View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5337_high_11 (Length: 241)
Name: NF5337_high_11
Description: NF5337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5337_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 38997668 - 38997445
Alignment:
| Q |
1 |
taatcttatgtttattatttactatttcgaaataacattttctaccattaattaatggtatcaacgtcaaaatctatgcaagagttgcctgtatcacaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
38997668 |
taatcttatgtttattatttactatttcaaaataacattttctaccattaattaatggtatcaacgtcaaaatctatgtaagagtttcctgtatcacaga |
38997569 |
T |
 |
| Q |
101 |
atattcatcaaatcaatcaaaccatgaaggtgaagaagagaggcgatgacgagagaacctggcactggatgtcaatcccgtggtgtttgtattccaaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38997568 |
atattcatcaaatcaatcaaaccatgaaggtgaagaagagaggcgacgacgagagaacctggcactggatgtcaatcccgtggtgtttgtattccaaact |
38997469 |
T |
 |
| Q |
201 |
ggtgcatgcagagaacattgcaag |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38997468 |
ggtgcatgcagagaacattgcaag |
38997445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 224
Target Start/End: Complemental strand, 39001677 - 39001605
Alignment:
| Q |
152 |
agagaacctggcactggatgtcaatcccgtggtgtttgtattccaaactggtgcatgcagagaacattgcaag |
224 |
Q |
| |
|
|||||||||| ||||||||||| || || | || |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
39001677 |
agagaacctgacactggatgtcgattcctagctgcttgtattccaaattagtgcatgcagagaacattgcaag |
39001605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University