View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5337_high_5 (Length: 334)
Name: NF5337_high_5
Description: NF5337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5337_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 253
Target Start/End: Original strand, 42491534 - 42491768
Alignment:
| Q |
16 |
atcgacgacatcaaacgttttgaggaaactgatgattgtttcatcctaggttttgatccttctgataactctcccgtcgacgcttcttctagacctcaca |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
42491534 |
atcgacgacatcaaacgtttcgaggaaactgatgattgttttatcctaggttttgatccttctgataactctcccatcgatgcttcttctagacctcaca |
42491633 |
T |
 |
| Q |
116 |
acaacgatgccgacgacgatgatgatctctgcgttcttggtgaaaagggcaaggtaaattcacccctaattattcaatttcatcaaaaacccattttcca |
215 |
Q |
| |
|
||||||||| | || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42491634 |
acaacgatg---atgatgatgatgatctctgcgttcttggacaaaagggcaaggtaaattcacccctaattattcaatttcatcaaaaacccattttcca |
42491730 |
T |
 |
| Q |
216 |
attgattttgatgaaaaaatttaaaatctaaatcacca |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42491731 |
attgattttgatgaaaaaatttaaaatctaaatcacca |
42491768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University