View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5338-Insertion-1 (Length: 135)
Name: NF5338-Insertion-1
Description: NF5338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5338-Insertion-1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 5e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 5e-51
Query Start/End: Original strand, 9 - 118
Target Start/End: Original strand, 55300404 - 55300513
Alignment:
| Q |
9 |
tttcatcatccccccacagtagtccttactacaaaggtcttaccgattactctcttgtcattgatgcctcttgggccactcctcatccccacccccatca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300404 |
tttcatcatccccccacagtagtccttactacaaaggtcttaccgattattctcttgtcattgatgcctcttgggccactcctcatccccacccccatca |
55300503 |
T |
|
| Q |
109 |
caactcatcc |
118 |
Q |
| |
|
||||||||| |
|
|
| T |
55300504 |
taactcatcc |
55300513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University