View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5339_high_11 (Length: 298)
Name: NF5339_high_11
Description: NF5339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5339_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 19 - 142
Target Start/End: Complemental strand, 40782965 - 40782842
Alignment:
| Q |
19 |
tcctgcaccgactaagccggagaaaagtgttcgggcttctgatgctccaaaagggtcttcagatagtccggctgatgattcgagtgctgttggtttgaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40782965 |
tcctgcaccgactaagccggagaaaagtgttcgggcttctgatgctccaaaagggtcttcggatagtccggctgatgattcgagtgctgttggtttgaat |
40782866 |
T |
 |
| Q |
119 |
ggctacatagttaatggtgctaca |
142 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40782865 |
ggctacatagttaatggtgctaca |
40782842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 255 - 290
Target Start/End: Complemental strand, 40782729 - 40782694
Alignment:
| Q |
255 |
ccttgagccagtttgagttgattgatgatgatgatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40782729 |
ccttgagccagtttgagttgattgatgatgatgatg |
40782694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University