View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5339_low_14 (Length: 287)
Name: NF5339_low_14
Description: NF5339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5339_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 61 - 272
Target Start/End: Original strand, 14811748 - 14811959
Alignment:
| Q |
61 |
taatttgtcatggcgtatcaactcacatctatgtcgagcaaaattagctcaatgctaccaacacaaccacggaaaaagctggtctcaacggaccacctac |
160 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
14811748 |
taatttttcatggcgtatcagctcacatctatgtcgagcaaaattagctcaatgctaccaacacgaccatggaaaaagctgctctcaacggaccacctac |
14811847 |
T |
 |
| Q |
161 |
gaaccaccctaaccttgatcttccagtccaccctaccagttgttagagagtgcaagtttatgaaaggcaacaccatttttctttagcacaatgttcttac |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14811848 |
aaaccaccctaaccttgatcttccagtccaccctaccagttgttagagagtgcaagtttgtgaaaggcaacaccatttttctttagcacaatgttcttac |
14811947 |
T |
 |
| Q |
261 |
aaagttagtttt |
272 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14811948 |
aaagttagtttt |
14811959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University