View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5341_high_3 (Length: 311)
Name: NF5341_high_3
Description: NF5341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5341_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 44461818 - 44462029
Alignment:
| Q |
1 |
ctgtcaagagtagaaccttccgccgactcaccaacattgttgttcttattaccagggccttgcctaaacgtacttcttctgtccaaccagtcaaagtgta |
100 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
44461818 |
ctgtcaagagtagaatcttccgcagactcaccaacattgttgttcttattaccagggccttgcctaaacgtactccttctgcccaaccagtcaaagtgta |
44461917 |
T |
 |
| Q |
101 |
atttaaatcatctttgctctgtgctatatattattgatcaagctcatatccttgttaaattttatgtgaatcttatatatatgattctatattattatta |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44461918 |
atttaaatcatctttgctctgtgc--tatattattgatcaagctcatatccttgttaaattttatgtgaatcttatatatatgattctatattattatta |
44462015 |
T |
 |
| Q |
201 |
aagagtgttgttaa |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44462016 |
aagagtgttgttaa |
44462029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 254 - 300
Target Start/End: Original strand, 44462068 - 44462114
Alignment:
| Q |
254 |
atgtgagaagaatgcaaaacaaaacaaaccggaaaacttgtcctatg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44462068 |
atgtgagaagaatgcaaaacaaaacaaaccggaaaacttgtcctatg |
44462114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University