View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5341_high_5 (Length: 243)
Name: NF5341_high_5
Description: NF5341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5341_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 237
Target Start/End: Complemental strand, 44461341 - 44461123
Alignment:
| Q |
19 |
gttgtctcttatttttcttgttcttctcggagttgggtttttattgattgttgtgtgcaaccacgaggatatggtagaggaaggtttcatggttttataa |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44461341 |
gttgtcacttatttttcttgttcttctcggagttgggtttttattgattgttgtgtgcaaccacgaggatatggtagaggaaggtttcatggttttataa |
44461242 |
T |
 |
| Q |
119 |
tggggggagagaggtacatttggtgtccagtgatttgttttttgctataataggaatttgtttgttattcaatacacttaatttggaggaagatctttac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44461241 |
tggggggagagaggtacatttggtgtccagtgatttgttttttgctataataggaatttgtttgttattcaatacacttaatttggaggaagatctttac |
44461142 |
T |
 |
| Q |
219 |
caaaaaatgaacccttcat |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44461141 |
caaaaaatgaacccttcat |
44461123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University