View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5341_high_5 (Length: 243)

Name: NF5341_high_5
Description: NF5341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5341_high_5
NF5341_high_5
[»] chr7 (1 HSPs)
chr7 (19-237)||(44461123-44461341)


Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 237
Target Start/End: Complemental strand, 44461341 - 44461123
Alignment:
19 gttgtctcttatttttcttgttcttctcggagttgggtttttattgattgttgtgtgcaaccacgaggatatggtagaggaaggtttcatggttttataa 118  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44461341 gttgtcacttatttttcttgttcttctcggagttgggtttttattgattgttgtgtgcaaccacgaggatatggtagaggaaggtttcatggttttataa 44461242  T
119 tggggggagagaggtacatttggtgtccagtgatttgttttttgctataataggaatttgtttgttattcaatacacttaatttggaggaagatctttac 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44461241 tggggggagagaggtacatttggtgtccagtgatttgttttttgctataataggaatttgtttgttattcaatacacttaatttggaggaagatctttac 44461142  T
219 caaaaaatgaacccttcat 237  Q
    |||||||||||||||||||    
44461141 caaaaaatgaacccttcat 44461123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University