View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5342-Insertion-7 (Length: 310)
Name: NF5342-Insertion-7
Description: NF5342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5342-Insertion-7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 28 - 208
Target Start/End: Original strand, 5994812 - 5995004
Alignment:
| Q |
28 |
ataagcaagcaaagctgattcaaacaaaaaccccaacttcaaagatcat------------ttcactaaccaaaacctagaaacaacgaagaatcactct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5994812 |
ataagcaagcaaagctgattcaaacaaaaaccccaacttcaaagatcatcacattcagtcattcactaaccaaaacctagaaacaacgaagaatcactct |
5994911 |
T |
 |
| Q |
116 |
ccaaacttgtcgatgtctccaacaccatcaaaaccagaagttctcttgaccaacaaattcctaagctttttgatatggcaatcaataccctca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5994912 |
ccaaacttgtcgatgtctccaacaccatcaaaaccagaagttctcttaaccaacaaattccttagctttttgatatggcaatcaataccctca |
5995004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 1665482 - 1665444
Alignment:
| Q |
167 |
aacaaattcctaagctttttgatatggcaatcaataccc |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1665482 |
aacaaattcgtaagctttttgatatggcaatcaataccc |
1665444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 172 - 208
Target Start/End: Original strand, 1887064 - 1887100
Alignment:
| Q |
172 |
attcctaagctttttgatatggcaatcaataccctca |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1887064 |
attcctaagctttttgatatggcaattaataccctca |
1887100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 172 - 208
Target Start/End: Complemental strand, 1671571 - 1671535
Alignment:
| Q |
172 |
attcctaagctttttgatatggcaatcaataccctca |
208 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
1671571 |
attcctaacctttttgatatggcaattaataccctca |
1671535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University