View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5343_high_24 (Length: 242)
Name: NF5343_high_24
Description: NF5343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5343_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 39291407 - 39291184
Alignment:
| Q |
1 |
taaatataagaaacgaaacgtattcgagcaaaccaagcagttattgttaacttcgtaaagatttgaaacgttttggattatgttatgattacgtttatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39291407 |
taaatataagaaacgaaacgtattcgagcaaaccaagaagttattgttaacttcgcaaagatttgaaacgttt-ggattatgttatgattacgtttatcc |
39291309 |
T |
 |
| Q |
101 |
tctgtaactactccgaatggtaccaatgcgcgtatcaaagcaattgcaccccttccaaggtttactccctctgcgcaatgtgtccataatgacagttcgt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39291308 |
tctgtaactacttcgaatggtaccaatgcgcgtatcaaagcgattgcaccccttccaaggtttactccctctgcgcaatgtgtccataatgacagttcgt |
39291209 |
T |
 |
| Q |
201 |
tttttagttatctatgtttataatt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39291208 |
tttttagttatctatgtttataatt |
39291184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University