View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5343_high_33 (Length: 228)
Name: NF5343_high_33
Description: NF5343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5343_high_33 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 228
Target Start/End: Complemental strand, 37305610 - 37305402
Alignment:
| Q |
20 |
catgaatacatcagccagcatcaaatgcttgtgataatatttacatatcacataatagggtcttaaataaactatgaaagtaatagggtcaaacaagata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37305610 |
catgaatacatcagccagcatcaaatgcttgtgataatatttacatatcacataatagggtcttaaataaactatgaaagtaatagggtcaaacaagata |
37305511 |
T |
 |
| Q |
120 |
ttttaaatagataccattcattatttgctaaagcatcaagaagagttgacttcccactaccagaaagacccattatagctaagaattgtcctggttttgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37305510 |
ttttaaatagataccattcattatttgctaaagcatcaagaagagttgacttcccactaccagaaagacccattatagctaagaattgtcctggttttgc |
37305411 |
T |
 |
| Q |
220 |
atagccttt |
228 |
Q |
| |
|
||||||||| |
|
|
| T |
37305410 |
atagccttt |
37305402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University