View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5343_low_20 (Length: 303)
Name: NF5343_low_20
Description: NF5343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5343_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 175 - 294
Target Start/End: Complemental strand, 26128412 - 26128293
Alignment:
| Q |
175 |
agaaagaaagatacgtgtttcaattctgactttggtttttgaaagattgatgcaagttttttgagagagtggttcctaatgaaattttgttggtgtgact |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
26128412 |
agaaagaaagatacgtgtttcaattctgactttggttgttgaaagattgatgcaagttttttgtgagattggttcctgatgaatttttgttggtgtgact |
26128313 |
T |
|
| Q |
275 |
ctgtgtttttggttgatgat |
294 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26128312 |
ctgtgtttttggttgatgat |
26128293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 74
Target Start/End: Complemental strand, 26128568 - 26128513
Alignment:
| Q |
19 |
tttgttggatcggttagcttgaaattgcttgtggcctttgttgttcgtttagaaca |
74 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26128568 |
tttgttggatcggtcggcttgaaattgcttgtggcctttgttgttcgtttagaaca |
26128513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University