View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5343_low_21 (Length: 291)
Name: NF5343_low_21
Description: NF5343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5343_low_21 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 134 - 291
Target Start/End: Original strand, 48690207 - 48690364
Alignment:
| Q |
134 |
gagctagtggggcagcagcacccttctttttaagaccaaaaaacttataactgcattatggaaaagttgaaaaaacagacgtagcacatacaatagatgt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48690207 |
gagctagtggggcagcagcacccttctttttaagaccaaaaaacttataactgcattatggaaaagttgaaaaaacagacgtagcacatacaatagatgt |
48690306 |
T |
|
| Q |
234 |
gctgtcagttttaaaattattgaattgtgttttataaagagcgtaagatttttcataa |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48690307 |
gctgtcagttttaaaattattgaattgtgttttataaagagcgtaagatttttcataa |
48690364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 54 - 88
Target Start/End: Original strand, 48690127 - 48690161
Alignment:
| Q |
54 |
cgggacggattcaaaaacttattagatttgggtag |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48690127 |
cgggacggattcaaaaacttattagatttgggtag |
48690161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 39
Target Start/End: Original strand, 48690097 - 48690126
Alignment:
| Q |
10 |
attattctcattcttatgacccacacttta |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48690097 |
attattctcattcttatgacccacacttta |
48690126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University