View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5343_low_27 (Length: 249)
Name: NF5343_low_27
Description: NF5343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5343_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 12 - 240
Target Start/End: Complemental strand, 26388122 - 26387909
Alignment:
| Q |
12 |
gggtggtagtgacttgaatgtatcttctgatatggataaaccaacaactagccagtagcaataaaccaacacaaactaatgtaatggcagcagcaacatg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
26388122 |
gggtggtagtgacttgaatgtatcttctgatatggataa-ccaaca--------gtagcaataaagcaacacaaactaatgtaatggcagca------tg |
26388038 |
T |
|
| Q |
112 |
tattgctgcacacaattaatgcctctagctccaagaatttaatcatcaatgaataacattctcatatcaaacaataaatggcattctcatgctaaactag |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26388037 |
tattgctgcacacaattaatgcgtctagctccaagaatttaatcatcaatgaataacattctcatatcaaacaataaatggcattctcatactaaactag |
26387938 |
T |
|
| Q |
212 |
taaattaactaactctaaaatgagtataa |
240 |
Q |
| |
|
|| ||||||||||| |||||||||||||| |
|
|
| T |
26387937 |
tacattaactaactttaaaatgagtataa |
26387909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 203 - 240
Target Start/End: Complemental strand, 26389214 - 26389177
Alignment:
| Q |
203 |
ctaaactagtaaattaactaactctaaaatgagtataa |
240 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
26389214 |
ctaaactagtacactaactaactctaaaatgagtataa |
26389177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University