View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5343_low_34 (Length: 238)
Name: NF5343_low_34
Description: NF5343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5343_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 48690416 - 48690641
Alignment:
| Q |
1 |
atatactacaattacaaatcatttatattctgaaggccgaccaagtgaaacctaaatcaagttttgatatatgggacctttttattcgcatatgcatcat |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
48690416 |
atatactacaattacaaatcattcatattctaaaggccaatcaagtgaaacctaaatcaagttttgatatatgggacctttttgttcgcatatgcaacat |
48690515 |
T |
 |
| Q |
101 |
ttttgtttataaaacttaatgaaaaacaacttttttaccgttagatcggtcctgcatattcttgatcgttactc----tatacataaggtggtaaagttt |
196 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||| ||| |
|
|
| T |
48690516 |
ttttgtttataaaatttaatgaaaaacaacttttttaccgttagatcggtcctgcatattcttgatccttactctatttatacataaggtagtaaaattt |
48690615 |
T |
 |
| Q |
197 |
gtttttgaaatgacggttaatgaaag |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48690616 |
gtttttgaaatgacggttaatgaaag |
48690641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University