View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5343_low_40 (Length: 223)
Name: NF5343_low_40
Description: NF5343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5343_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 31439211 - 31439414
Alignment:
| Q |
1 |
aacagaatcccggatttccgccgggaatcgatcctgatgtcgaaagtccctgtccagttaccggaaggtgaaatcaaagtatcgttcaacgccgacgcgc |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31439211 |
aacagaatcccgtatttccgccgggaatcgatcctgatgtcgaaagtccctgtccagttaccggaaggtgaaatcaaagtatcgttcaacgccgacgcgc |
31439310 |
T |
 |
| Q |
101 |
ctctccgtgagagaatttttaccttcactcgagaatcaattcagaagctaaaagcaacggtgaataagaacattaaccaccgtacatctccggaaaatgc |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31439311 |
ctctccgtgagagaattttcaccttcactcgagaatcaattcagaagctaaaagcaacggtgaataagaacattaaccaccgtacatcaccggaaaatgc |
31439410 |
T |
 |
| Q |
201 |
tgac |
204 |
Q |
| |
|
|||| |
|
|
| T |
31439411 |
tgac |
31439414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University