View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5345-Insertion-12 (Length: 87)
Name: NF5345-Insertion-12
Description: NF5345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5345-Insertion-12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 2e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 2e-36
Query Start/End: Original strand, 7 - 87
Target Start/End: Complemental strand, 45514075 - 45513995
Alignment:
| Q |
7 |
acactgatggtagagtggactggccaggtgttacagttcttcgcaacccaaacaaagcactccctttcactgcttcctatc |
87 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45514075 |
acactgatggtagagtggattggccaggtgttacagttcttcgcaacccaaacaaagcactccctttcactgcttcctatc |
45513995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 7 - 87
Target Start/End: Complemental strand, 43699273 - 43699193
Alignment:
| Q |
7 |
acactgatggtagagtggactggccaggtgttacagttcttcgcaacccaaacaaagcactccctttcactgcttcctatc |
87 |
Q |
| |
|
||||||||||||||||| | ||||| ||||||| |||| |||||||| | || |||||||||| ||||||||||| |||| |
|
|
| T |
43699273 |
acactgatggtagagtgaattggcctggtgttaaagttattcgcaactcggaccaagcactcccgttcactgcttcatatc |
43699193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University