View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5345-Insertion-13 (Length: 137)
Name: NF5345-Insertion-13
Description: NF5345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5345-Insertion-13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 2e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 44 - 137
Target Start/End: Complemental strand, 4949081 - 4948986
Alignment:
| Q |
44 |
tcgttgttgagtaaacttattgatgtagtagattaaat--tccttcaaatggttaattttgaatgattaaagcctgtcgtatgcttcccaggagat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4949081 |
tcgttgttgagtaaacttattgatgtagtagattaaatattccttcaaatggttaattttggatgattaaagcctgtcgtatgcttcccaggagat |
4948986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University