View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5345_low_6 (Length: 405)
Name: NF5345_low_6
Description: NF5345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5345_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 4e-97; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 138 - 359
Target Start/End: Original strand, 4359321 - 4359552
Alignment:
| Q |
138 |
agagagatattgaaacacaaagaaagggatgaattgaggaggaagggtaatgggtctatatatatat--------gggaaag--gggagaaagaaaaacg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
4359321 |
agagagatattgaaacacaaagaaagggttgaattgaggaggaagggtaatgggtctatatatatatatatatatgggaaagaggggagaaagaaaaacg |
4359420 |
T |
 |
| Q |
228 |
tggttttattatttagtgcttgggtgggtgggtttgtgttgccttaagagttaagaggttgtagttgaatctcacgtgagattgtgtagtctaaatgaaa |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4359421 |
tggttttattatttagtgcttgggtgggtgggtttgtgttgccttaagagttaagaggttgtagttgaatctcacgtgagattgtgtagtttaaatgaaa |
4359520 |
T |
 |
| Q |
328 |
atgtcacgtgactttaaaaaatcatggacgta |
359 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
4359521 |
atgtcacgtgactataaaaaatcatggacgta |
4359552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 4352931 - 4352866
Alignment:
| Q |
137 |
gagagagatattgaaacacaaagaaagggatgaattgaggaggaagggtaatgggtctatatatat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
4352931 |
gagagagatattgaaacacaaagaaagggatgaattgaagaggaagggaaatgggtgtatatatat |
4352866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 204
Target Start/End: Complemental strand, 4349507 - 4349463
Alignment:
| Q |
160 |
aaagggatgaattgaggaggaagggtaatgggtctatatatatat |
204 |
Q |
| |
|
||||||||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
4349507 |
aaagggatgaattgaagaggaagggtgatgggtatatatatatat |
4349463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University