View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5347-Insertion-11 (Length: 216)
Name: NF5347-Insertion-11
Description: NF5347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5347-Insertion-11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 6 - 216
Target Start/End: Complemental strand, 47436292 - 47436082
Alignment:
| Q |
6 |
caaatctgagttatcttgaaacaccgtggacaaaaggtaaacgttcaaagcgttctcgtatggatcaatcttcatgcactgaagaagagtatctcgctct |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47436292 |
caaatctgagttatcttgaaacaccgtggacgaaaggtaaacgttcaaagcgttctcgtatggatcaatcttcatgcactgaagaagagtatctcgctct |
47436193 |
T |
|
| Q |
106 |
ttgtctcatcatgcttgctcgcagcggaaacaacaacgacaacaagactgaatcggtgccggtgccggcgccgctaaccaccgttaaactcagtcacaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47436192 |
ttgtctcatcatgcttgctcgcagcggaaacaacaacgacaacaagactgaatcggtgccggtgccggcgccgctaaccaccgttaaactcagtcacaaa |
47436093 |
T |
|
| Q |
206 |
tgctcagtctg |
216 |
Q |
| |
|
||||||||||| |
|
|
| T |
47436092 |
tgctcagtctg |
47436082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 76 - 126
Target Start/End: Original strand, 5294563 - 5294613
Alignment:
| Q |
76 |
ttcatgcactgaagaagagtatctcgctctttgtctcatcatgcttgctcg |
126 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5294563 |
ttcatgcactgaagaagaatatctcgctctttgtctcatcatgcttgctcg |
5294613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University