View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5347_high_29 (Length: 228)
Name: NF5347_high_29
Description: NF5347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5347_high_29 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 144 - 228
Target Start/End: Complemental strand, 39442685 - 39442599
Alignment:
| Q |
144 |
ataattcatttaccttagcaa--ttgatttactatattctcttcttcatagatagtactttagtgtaacaattgattttggttgttt |
228 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39442685 |
ataattcatttaccttagcaaaattgatttactatattctcttcttcacagatagtactttagtgtaacaattgattttggttgttt |
39442599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 60
Target Start/End: Complemental strand, 39442767 - 39442730
Alignment:
| Q |
23 |
tgttttctaactctcggcaactagtcaactacaccagg |
60 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39442767 |
tgttttctaactctcggcaactagtcaacaacaccagg |
39442730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 144 - 219
Target Start/End: Complemental strand, 19286773 - 19286697
Alignment:
| Q |
144 |
ataattcatttaccttagcaattgatttactatattctcttcttcatagatagt-actttagtgtaacaattgattt |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | || |||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
19286773 |
ataatttatttaccttagcaattgatttactttgttgtcttcttcatagattgtgtctttagtttaacaattgattt |
19286697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University