View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5347_low_18 (Length: 271)
Name: NF5347_low_18
Description: NF5347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5347_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 9786940 - 9787099
Alignment:
| Q |
1 |
gccacaatctaatgctgccgtatcctgccagcaaaataattggctatggatcagaaatttaatcattgaaattgttggactgggattgcatgtggtagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9786940 |
gccacaatctaatgctgccgtatcctgccaacaaaataattggctatgaatcagaaatttaatcattgaaattgttggactgggattgcatgtggtagtg |
9787039 |
T |
 |
| Q |
101 |
attccatgcagcttcatgctataaaattttatggtcattaatttcatatcagatgactca |
160 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
9787040 |
attccatgcagcttcatgctataaataattatggtcattaatttcatatcggatgactca |
9787099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 181 - 254
Target Start/End: Complemental strand, 9786808 - 9786735
Alignment:
| Q |
181 |
ttaaatctccttacttgttggggtatggtatgttgggtgaaaattgatgtaaattgttctcaatgatttatatg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9786808 |
ttaaatctccttacttgttggggtatggtatgttgggtgaaaattaatgtaaattgttctcaatgatttatatg |
9786735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University