View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5347_low_22 (Length: 251)

Name: NF5347_low_22
Description: NF5347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5347_low_22
NF5347_low_22
[»] chr2 (1 HSPs)
chr2 (84-242)||(39435640-39435802)
[»] chr1 (1 HSPs)
chr1 (159-200)||(22094881-22094922)


Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 84 - 242
Target Start/End: Complemental strand, 39435802 - 39435640
Alignment:
84 ggttgctcgttgaatgaacaagttaacgatataggcgtaagtgaaaatgaaaatagagaagtaggaatggttagtgaacaagataacaatatagacacaa 183  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39435802 ggttgctcgttgaatgaacaagttaacaatataggcgtaagtgaaaatgaaaatagagaagtaggaatggttagtgaacaagataacaatatagacacaa 39435703  T
184 atgaaagtgaaaatagagacttgattcttttccaaatgc-----tttattgcttatagaataat 242  Q
    |||||||||||||||||||||| ||||||||||||||||     ||||||||||||||||||||    
39435702 atgaaagtgaaaatagagactt-attcttttccaaatgcttttttttattgcttatagaataat 39435640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 200
Target Start/End: Complemental strand, 22094922 - 22094881
Alignment:
159 gaacaagataacaatatagacacaaatgaaagtgaaaataga 200  Q
    |||||||||||||||||||| |||||||||| ||||||||||    
22094922 gaacaagataacaatatagaaacaaatgaaattgaaaataga 22094881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University