View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5347_low_26 (Length: 242)

Name: NF5347_low_26
Description: NF5347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5347_low_26
NF5347_low_26
[»] chr8 (1 HSPs)
chr8 (96-223)||(31407229-31407364)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 31407229 - 31407364
Alignment:
96 ttatggagtcagggtcgacaaaagagtggttgttatagatagacgattgtacgacgaacatggaaaggtttggttatgctcgaattat--------ctac 187  Q
    |||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||        ||||    
31407229 ttatggagtcagggtcgacaaaagagcggttgtaatagatagacgattgtacgacgaacatggaaaggtttggttatgcacgaattatggtattgactac 31407328  T
188 ttcattgattgaaattaatggggttgtggaagtttt 223  Q
    ||||||||||||||||||||||||||||||||||||    
31407329 ttcattgattgaaattaatggggttgtggaagtttt 31407364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University