View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5347_low_26 (Length: 242)
Name: NF5347_low_26
Description: NF5347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5347_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 31407229 - 31407364
Alignment:
| Q |
96 |
ttatggagtcagggtcgacaaaagagtggttgttatagatagacgattgtacgacgaacatggaaaggtttggttatgctcgaattat--------ctac |
187 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
31407229 |
ttatggagtcagggtcgacaaaagagcggttgtaatagatagacgattgtacgacgaacatggaaaggtttggttatgcacgaattatggtattgactac |
31407328 |
T |
|
| Q |
188 |
ttcattgattgaaattaatggggttgtggaagtttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31407329 |
ttcattgattgaaattaatggggttgtggaagtttt |
31407364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University