View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5348_high_18 (Length: 228)
Name: NF5348_high_18
Description: NF5348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5348_high_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 10 - 228
Target Start/End: Original strand, 38574695 - 38574913
Alignment:
| Q |
10 |
ccaagagccaattctaccttctagacatgggaagttgttggaagaacaatggtgcaccttgtgatggagatgtactaactgatgtcactagatacagtga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38574695 |
ccaagagccaattctaccttctagacatgggaagttgttggaagaacaatggtgcaccttgtgatggagatgtactaactgatgtcactagatacagtga |
38574794 |
T |
|
| Q |
110 |
aatgatcatcaatccagaaactccagcttggtgtagccctacaggtttaggaaattgtccaccatttcatatcacaccagataacaaaaagatattcaga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38574795 |
aatgatcatcaatccagaaactccagcttggtgtagccctacaggtttaggaaattgtccaccatttcatatcacaccagataacaaaaagatattcaga |
38574894 |
T |
|
| Q |
210 |
aatgacactaccaatttcc |
228 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
38574895 |
aatgacactgccaatttcc |
38574913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 61
Target Start/End: Complemental strand, 30818043 - 30817996
Alignment:
| Q |
14 |
gagccaattctaccttctagacatgggaagttgttggaagaacaatgg |
61 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
30818043 |
gagccaattctacctcatggacatgggaagttgttggaagaacaatgg |
30817996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University