View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5348_high_21 (Length: 201)

Name: NF5348_high_21
Description: NF5348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5348_high_21
NF5348_high_21
[»] chr7 (1 HSPs)
chr7 (18-123)||(30347344-30347449)


Alignment Details
Target: chr7 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 18 - 123
Target Start/End: Original strand, 30347344 - 30347449
Alignment:
18 aattatacattgcataacaatatatgtccgcgtaacacactcaattgaataacactctatgtgattgctccattttttcaaaaaatcatcacactcatct 117  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30347344 aattatacattgcataacaatatatgtccgagtaacacactcaattgaataacactctatgtgattgctccattttttcaaaaaatcatcacactcatct 30347443  T
118 tatacg 123  Q
    ||||||    
30347444 tatacg 30347449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University