View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5348_low_17 (Length: 249)
Name: NF5348_low_17
Description: NF5348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5348_low_17 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 38575277 - 38575044
Alignment:
| Q |
16 |
atcaccgtgtcacaaaaatttcgccataacataaatacgaatttgctagagacacaaatgaatgagtatgtgatgtaatgtgatgactcataagtttcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38575277 |
atcaccgtgtcacaaaaatttcgccataacataaatacgaatttgcaagagacacaaatgaatgagtatgtgatgtaatgtgatgactcataagtttcca |
38575178 |
T |
|
| Q |
116 |
atattagagtgataattgaatgattgacctgatagaagtaaagtctacttgctaggccaccaacatcaagttcccaagtccttgcatcaccaacccaacc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38575177 |
atattagagtgataattgaatgattgacctgatagaagtaaagtctacttgctaggccaccaacatcaagttcccaagtccttgcatcaccaacccaacc |
38575078 |
T |
|
| Q |
216 |
atcacctttattattgcgctaaccatcctcaccc |
249 |
Q |
| |
|
||||||||||||| || | ||||||| ||||||| |
|
|
| T |
38575077 |
atcacctttattaatgggataaccatactcaccc |
38575044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University