View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5349_low_16 (Length: 280)
Name: NF5349_low_16
Description: NF5349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5349_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 29564596 - 29564396
Alignment:
| Q |
17 |
aaaattacctttgtaaattccatcctttaatcctatactttcttaagcgcacaatgtttcaaacatacatacattcttctatatctatctaacactagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29564596 |
aaaattacctttgtaaattccatcctttaatcctatactttcttaagcgcacgatgtttcaaacatacatacattcttctatatctatctaacactagta |
29564497 |
T |
 |
| Q |
117 |
gctcaattggtttgcgctaatcgtt-aaggtttagaatttaaaccctagtaaagnnnnnnnntactaacataacaactaatatactattgtttttcttca |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29564496 |
gctcaattggtttgcgctaatcgttaaaggtttagaatttaaaccctagtaaagaaaaaaaatactaacatatcaactaatatactattgtttttcttca |
29564397 |
T |
 |
| Q |
216 |
t |
216 |
Q |
| |
|
| |
|
|
| T |
29564396 |
t |
29564396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University