View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5349_low_22 (Length: 243)
Name: NF5349_low_22
Description: NF5349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5349_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 22 - 225
Target Start/End: Original strand, 18714988 - 18715196
Alignment:
| Q |
22 |
ataccatccaaccactgataa-tccaaacaaatgtatcattctttttaattcaatggtcctttatgttatttaattatattagattgtcatttatcattc |
120 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18714988 |
ataccatccaaccactgatcagtccaaacaaatgtatcattctttttaattcaatggtcctttatgttatttaattatattagattgtcttttatcattc |
18715087 |
T |
|
| Q |
121 |
ttttttctcatgtgcgtcttttat-attacaaacacgcacaagtttatctctttatgttttttcttcatttttattagaaaactgatgaggtg---gtaa |
216 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18715088 |
ttttttctcatgtgtgtcttttatcattacaaacacgcacaagtttatctctttatgttttttcttcatttttattagaaaactgatgaggtggtggtaa |
18715187 |
T |
|
| Q |
217 |
gtcacatag |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
18715188 |
gtcacatag |
18715196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University