View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5349_low_23 (Length: 240)
Name: NF5349_low_23
Description: NF5349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5349_low_23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 34 - 240
Target Start/End: Complemental strand, 15673361 - 15673156
Alignment:
| Q |
34 |
ttatagcaaccaacacttaacaactcctaagtaaccaactaacactaactgaaattattctgacttgaatacctcttagaatcaatgtctaaaatctata |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
15673361 |
ttatagcaaccaacacttaacaactcctaagtaaccaactaacactaactggaattattctgacttgtgtacctctaagaatcaatgtctaaaatctata |
15673262 |
T |
|
| Q |
134 |
acctcttaatannnnnnnacttggatatttttagtaatatttgtactccatgttttggtataaaatattgcttatcacaaagaaaaaaggaccggagaat |
233 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15673261 |
acctcttaata-ttttttacttggatattttcagtaatatttgtactccatgttttggtataaaatattgcttatcacaaagaaaaaaggaccggagaat |
15673163 |
T |
|
| Q |
234 |
catattt |
240 |
Q |
| |
|
||||||| |
|
|
| T |
15673162 |
catattt |
15673156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University