View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5349_low_26 (Length: 236)
Name: NF5349_low_26
Description: NF5349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5349_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 19 - 96
Target Start/End: Original strand, 16700651 - 16700728
Alignment:
| Q |
19 |
atgaatataatctatgatacattttattccctaatctcaactttttaaaggcattatctcaaacttaaaccaattcca |
96 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16700651 |
atgaatataatatatgatacattttattccctaatctcaactttttaaaggcattatctcaaacttaaaccaattcca |
16700728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 16700809 - 16700854
Alignment:
| Q |
177 |
gtcttgttgtcagcaaaactattataaaataaggacaagttatttt |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16700809 |
gtcttgttgtcagcaaaactatcataaaataaggacaagttatttt |
16700854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University