View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5350-Insertion-7 (Length: 234)
Name: NF5350-Insertion-7
Description: NF5350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5350-Insertion-7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 8 - 215
Target Start/End: Original strand, 10760289 - 10760496
Alignment:
| Q |
8 |
ccttctacctctctcgatttcacatcccaattgcagctttgaaatggccaactccagtgccaccccaaatcacaattcgggaaacagttatgcttcctga |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10760289 |
ccttctacctccctcgatttcacatcccaattgcagctttgaaatggccaactccagtgccaccccaaatcacaattcgggaaacagttttgcttcctga |
10760388 |
T |
|
| Q |
108 |
tcatgttttaatgttcttaaactaccctttatcttatcgctatcacaccaaacatgaccttcaatgtgtttactcttcagatgatgactcaaaacctcgt |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10760389 |
tcatgttttaattttcttaaactaccctttatcttttcgctatcacaccaaacgtgaccttcaatgtgtttactcttcagatcatgactcaaaacctcgt |
10760488 |
T |
|
| Q |
208 |
ctcactca |
215 |
Q |
| |
|
|||||||| |
|
|
| T |
10760489 |
ctcactca |
10760496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University