View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5350_low_4 (Length: 289)
Name: NF5350_low_4
Description: NF5350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5350_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 277
Target Start/End: Original strand, 24834127 - 24834383
Alignment:
| Q |
19 |
tcactgaggtattttacatttttaattattcttgcacttaaagtatattttgttcatctctatatgttgttctgaaaatcttgatttgatttgaatatgt |
118 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||| |
|
|
| T |
24834127 |
tcactgaggtattttacctttttaattactcttgcacttaaagtatattttgttcatctctat--gttgtgctgaaaatcttgctttgatttgaatatgt |
24834224 |
T |
 |
| Q |
119 |
ttcaggaggataccaattcagacaaacctaacaggagtgataactgaaatggagaagtgattgttatttgcatcgtaccaagagaatttttatttcagat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24834225 |
ttcaggaggataccaattcagacaaacctaacaggagtgataactgaaatggagaagtgattgttatttgcattgtaccaagagaatttttatttcagat |
24834324 |
T |
 |
| Q |
219 |
tgtgggatattttaagaagtatttaagttgtaaaccaaataaatataaatatttgtgat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24834325 |
tgtgggatattttaagaagtatttaagttgtaaaccaaataaatataaatatttgtgat |
24834383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University