View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5350_low_7 (Length: 246)
Name: NF5350_low_7
Description: NF5350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5350_low_7 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 133 - 246
Target Start/End: Original strand, 21597525 - 21597637
Alignment:
| Q |
133 |
tatatgattttggaaggggagagag--ctcacttaaattaaatctattaaagtggattttggagacagtaaatttagtaggtgttatgcatcatcgcata |
230 |
Q |
| |
|
||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
21597525 |
tatatgattttagaaggggggagagaactcacttaaattaaatctattaaagtggattttggagacaataaatttaataggtgttatg---catcgcata |
21597621 |
T |
 |
| Q |
231 |
acacacgtattaaatt |
246 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
21597622 |
acacacctattaaatt |
21597637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 95 - 141
Target Start/End: Original strand, 21597297 - 21597342
Alignment:
| Q |
95 |
tgagatacaaatgaagtttgagatttatggttcactggtatatgatt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21597297 |
tgagatacaaatgaagtttgagatttatggttcact-gtatatgatt |
21597342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University