View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5351-Insertion-6 (Length: 495)
Name: NF5351-Insertion-6
Description: NF5351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5351-Insertion-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 447; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 447; E-Value: 0
Query Start/End: Original strand, 16 - 495
Target Start/End: Original strand, 44166457 - 44166936
Alignment:
| Q |
16 |
tgatcaaacacaatagttaggcacttaattggacctttatgcccttccaaaacactcaaacaacaatactctctaagaacattattagtattacctcgcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166457 |
tgatcaaacacaatagttaggcacttaattggacctttatgcccttccaaaacactcaaacaacaatactctctaagaacattattagtattacctcgcc |
44166556 |
T |
|
| Q |
116 |
aaattcgaattgtcttatcctcagaaccactgcacaccaaatcagataccacagccaaacacaatatagactttgtgtgaccacgtagagcacctatgac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166557 |
aaattcgaattgtcttatcctcagaaccactgcacaccaaatcagaaaccacagccaaacacaatatagactttgtgtgaccacgtagagcacctatgac |
44166656 |
T |
|
| Q |
216 |
tatcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgtcactgttaagagccaatgcatta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166657 |
tatcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgtcactgttaagagccaatgcatta |
44166756 |
T |
|
| Q |
316 |
atcccagatctctgcttctccaaagtatcaactaacaaatgtttcttatctcctttatttttcttccaaaccttaannnnnnnatctgttgatccggtgt |
415 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44166757 |
atcccagatctgtgcttctccaaagtatcaactaacaaatgtttcttatctcctttatttttcttccaaaccttaatttttttatctgttgatccggtgt |
44166856 |
T |
|
| Q |
416 |
aaacatatccatcgttagaaactgtgattgcgtttattgcatcgtcgtgtgcgttttgcactgattccaaacatgtcaag |
495 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44166857 |
aaacatatccatcgttagaaactgtgattgcgtttattgcatcgtcgtgtgcgttttgcaatgattccaaacatgtcaag |
44166936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University