View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5352-Insertion-2 (Length: 199)

Name: NF5352-Insertion-2
Description: NF5352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5352-Insertion-2
NF5352-Insertion-2
[»] chr1 (1 HSPs)
chr1 (7-185)||(11761661-11761839)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 7 - 185
Target Start/End: Complemental strand, 11761839 - 11761661
Alignment:
7 agaatcaatatagttacatgggataaagaatggaatttacttcccatgaggcaggtgaacaaatgaatgaaatttattcagtattaataatacttgatga 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
11761839 agaatcaatatagttacatgggataaagaatggaatttacttcccatgaggcaggtgaacaaatgaatgaaatttattcagtattaatgatacttgatga 11761740  T
107 atcgacttaagataaccatttttctttcaatgggtaggaaactatcctcaccaatccataactgatgcactccatccag 185  Q
    |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |||||    
11761739 atcgacttaagataaccatttttcttccaatgggtagaaaactatcctcaccaatccataactgatgcactccttccag 11761661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University