View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5352_low_7 (Length: 300)
Name: NF5352_low_7
Description: NF5352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5352_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 19 - 289
Target Start/End: Original strand, 46910905 - 46911175
Alignment:
| Q |
19 |
ccagaaacctagtaatccccaccagtggaaagttaacaggtgcacatgaaagttttgttgttggttcactaaaatccagaactgttgatggggatttgat |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46910905 |
ccagcaacctagtaatccccaccagtggaaagttaacaggtgcacatgaaagttttgttgttggttcactaaaatccagaactgttgatggggatttgat |
46911004 |
T |
|
| Q |
119 |
gggtttgagtgatatgcttccaatgaaccgtgaagaaagtattacactagctgacatcagtttctgtgccagattccccacaacaggatctctgactaaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46911005 |
gggtttgagtgatatgcttccaatgaaccgtgaagaaagtagtacactagctgacatcagtttctgtgccagattccccacaacaggatctctgactaaa |
46911104 |
T |
|
| Q |
219 |
gagcaataaaagttcaaataaccccaaaggatgctagatagcaacaaacaaaactgtgatactaacctatg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46911105 |
gagcaataaaagttcaaataaccccaaaggatgctagatagcaacaaacaaaactgtgatactaacctatg |
46911175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University