View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5354_low_2 (Length: 239)
Name: NF5354_low_2
Description: NF5354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5354_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 9 - 198
Target Start/End: Complemental strand, 32443756 - 32443567
Alignment:
| Q |
9 |
acatcatcaccctctcatcatgaatcttgtcgacgaagaactcagcgaaccttactccatcttcacctatcgctacttcgtttatctatggcctcatctt |
108 |
Q |
| |
|
|||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32443756 |
acatcacctccctctcatcatgaaccttgtcgacgaagaactcagcgaaccttactccatcttcacctatcgctacttcgtttatctatggcctcatctt |
32443657 |
T |
 |
| Q |
109 |
tcttttctggtgctaaatctttcctcttttcacctttttattatctgggtaatttttcaattcaccgttaatcactttgatttattaaca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32443656 |
tcttttctggtgctaaatctttcctctttttacctttttattatctgggtaatttttcaattcaccgttaatcactttgatttattaaca |
32443567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University