View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5354_low_2 (Length: 239)

Name: NF5354_low_2
Description: NF5354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5354_low_2
NF5354_low_2
[»] chr7 (1 HSPs)
chr7 (9-198)||(32443567-32443756)


Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 9 - 198
Target Start/End: Complemental strand, 32443756 - 32443567
Alignment:
9 acatcatcaccctctcatcatgaatcttgtcgacgaagaactcagcgaaccttactccatcttcacctatcgctacttcgtttatctatggcctcatctt 108  Q
    |||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32443756 acatcacctccctctcatcatgaaccttgtcgacgaagaactcagcgaaccttactccatcttcacctatcgctacttcgtttatctatggcctcatctt 32443657  T
109 tcttttctggtgctaaatctttcctcttttcacctttttattatctgggtaatttttcaattcaccgttaatcactttgatttattaaca 198  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32443656 tcttttctggtgctaaatctttcctctttttacctttttattatctgggtaatttttcaattcaccgttaatcactttgatttattaaca 32443567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University