View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5355-Insertion-16 (Length: 118)
Name: NF5355-Insertion-16
Description: NF5355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5355-Insertion-16 |
 | |
|
| [»] chr1 (8 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 2e-53; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 9 - 118
Target Start/End: Complemental strand, 27215233 - 27215124
Alignment:
| Q |
9 |
caacaacaatggaaagttcagctgtgccaccgccgattgtgcctctggtcaactcggttgcaacggtgctggcgcaatcccaccagcaacattggtagaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27215233 |
caacaacaatggaaagttcagctgtgccaccgccgattgtgcctctggtcaactcggttgcaatggtgctggcgcaatcccaccagcaacattggtagaa |
27215134 |
T |
|
| Q |
109 |
ataaccgtag |
118 |
Q |
| |
|
|||||||||| |
|
|
| T |
27215133 |
ataaccgtag |
27215124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 9 - 118
Target Start/End: Original strand, 27443668 - 27443777
Alignment:
| Q |
9 |
caacaacaatggaaagttcagctgtgccaccgccgattgtgcctctggtcaactcggttgcaacggtgctggcgcaatcccaccagcaacattggtagaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27443668 |
caacaacaatggaaagttcagctgtgccaccgccgattgtgcctctggtcaactcggttgcaatggtgctggcgcaatcccaccagcaacattggtagaa |
27443767 |
T |
|
| Q |
109 |
ataaccgtag |
118 |
Q |
| |
|
|||||||||| |
|
|
| T |
27443768 |
ataaccgtag |
27443777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 27432943 - 27432833
Alignment:
| Q |
8 |
ccaacaacaatggaaagttcagctgtgccaccgccgattgtgcctctggtcaactcggttgcaacggtgctggcgcaatcccaccagcaacattggtaga |
107 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27432943 |
ccaacaacaatggaaagttcagttgtgccaccgccgattgtgcctctggtcaagtcggttgtaacggtgctggcgcaatcccaccagcaacattggtaga |
27432844 |
T |
|
| Q |
108 |
aataaccgtag |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
27432843 |
aataaccgtag |
27432833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 9 - 118
Target Start/End: Complemental strand, 27221195 - 27221086
Alignment:
| Q |
9 |
caacaacaatggaaagttcagctgtgccaccgccgattgtgcctctggtcaactcggttgcaacggtgctggcgcaatcccaccagcaacattggtagaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27221195 |
caacaacaatggaaagttcagctgtgccaccgccgattgtgcctctggtcaagtcggttgcaacggtgctggggcaatcccaccagcaacattggtagaa |
27221096 |
T |
|
| Q |
109 |
ataaccgtag |
118 |
Q |
| |
|
||||| |||| |
|
|
| T |
27221095 |
ataacggtag |
27221086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 11 - 113
Target Start/End: Complemental strand, 27207860 - 27207758
Alignment:
| Q |
11 |
acaacaatggaaagttcagctgtgccaccgccgattgtgcctctggtcaactcggttgcaacggtgctggcgcaatcccaccagcaacattggtagaaat |
110 |
Q |
| |
|
||||||| |||| ||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27207860 |
acaacaacggaaggttcagctgcgccaccgccgattgtgcctccggtcaagtcggttgcaacggtgctggcgcaatcccaccagcaacactggtagaaat |
27207761 |
T |
|
| Q |
111 |
aac |
113 |
Q |
| |
|
||| |
|
|
| T |
27207760 |
aac |
27207758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 31 - 110
Target Start/End: Complemental strand, 27389134 - 27389055
Alignment:
| Q |
31 |
tgtgccaccgccgattgtgcctctggtcaactcggttgcaacggtgctggcgcaatcccaccagcaacattggtagaaat |
110 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| | | ||||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
27389134 |
tgtgccactgccgattgtgcatctggtcaagttgcatgcaatggtgctggcgcaatcccaccagcaactttggttgaaat |
27389055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 43; E-Value: 6e-16
Query Start/End: Original strand, 12 - 98
Target Start/End: Complemental strand, 27410109 - 27410023
Alignment:
| Q |
12 |
caacaatggaaagttcagctgtgccaccgccgattgtgcctctggtcaactcggttgcaacggtgctggcgcaatcccaccagcaac |
98 |
Q |
| |
|
|||||| | |||||| || |||||||| |||||||||| ||||||||| | || ||||| |||||||||||||||||||||||||| |
|
|
| T |
27410109 |
caacaaagaaaagtttagttgtgccacagccgattgtgggtctggtcaagtggggtgcaatggtgctggcgcaatcccaccagcaac |
27410023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 34 - 113
Target Start/End: Complemental strand, 27454834 - 27454755
Alignment:
| Q |
34 |
gccaccgccgattgtgcctctggtcaactcggttgcaacggtgctggcgcaatcccaccagcaacattggtagaaataac |
113 |
Q |
| |
|
||||| ||||||||| ||| |||||| | |||| ||| | ||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
27454834 |
gccactgccgattgtatctccggtcaaatgggttccaatgatgcaggtgcaatcccaccagcaacattggtagaaataac |
27454755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University