View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5355-Insertion-8 (Length: 180)
Name: NF5355-Insertion-8
Description: NF5355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5355-Insertion-8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 7e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 8 - 180
Target Start/End: Original strand, 42476230 - 42476402
Alignment:
| Q |
8 |
tgaatcacaattaggattttagaattatgaagttttatttattgttatgttagtcatcgtaaccatgtggtaacaaacacttggaacttaattgatgtcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42476230 |
tgaatcacaattaggattttagaattatgaagttttatttattgttatgttagtcatcgtaaccatgtggtaacaaacacttggaacttaattgatgtcc |
42476329 |
T |
|
| Q |
108 |
ttaaatattttactatattcagattttaatagcaaactttttcatttattacaaatttgaattcaatcggtcc |
180 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42476330 |
ttaaattttttactatattcagattttaatagcaaactttttcatttattacaaatttgaattcaatcggtcc |
42476402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University