View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5355_high_13 (Length: 333)
Name: NF5355_high_13
Description: NF5355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5355_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 310; Significance: 1e-175; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 12945827 - 12945502
Alignment:
| Q |
1 |
tcactaacaagaaactacattgtgcccaccgtgccatcatcctccgatcccactaattcgccaccgcaaccggctctctctaaggacattcccttaaacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
12945827 |
tcactaacaagaaactacattgtgcccaccgtgccatcatcctccgatcccactaattcgccactgcaaccggctctctctaaagacattcccttaaacg |
12945728 |
T |
|
| Q |
101 |
ccgctgcgaaaacctccattcgtctcttcctcccgaaccctccaccgtcttcctctgctgccaaactccccattattctctacttccatggtggtggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12945727 |
ccgctgcgaaaacctccattcgtctcttcctcccgaaccctccaccgtcttcctctgctgccaaactccccattattctctacttccatggtggtggttt |
12945628 |
T |
|
| Q |
201 |
catcctctaccacccttcctcgctcattttccaccatccctgctctacattagctgctcaaattcctgccattgttgcctcggttgattatcgtctctcg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12945627 |
catcctctaccacccttcctcgctcattttccaccacccctgctctacattagctgctcaaattcctgccattgttgcctccgttgattatcgtctctcg |
12945528 |
T |
|
| Q |
301 |
cctgagcatcgcctcccagcagccta |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
12945527 |
cctgagcatcgcctcccagcagccta |
12945502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 112 - 218
Target Start/End: Complemental strand, 12938044 - 12937938
Alignment:
| Q |
112 |
acctccattcgtctcttcctcccgaaccctccaccgtcttcctctgctgccaaactccccattattctctacttccatggtggtggtttcatcctctacc |
211 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||| |||| || || || || ||||| | ||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
12938044 |
acctccatccgcatcttcctcccaaaccctccaccaccttcttccgcggctaagctccctctcattctctacttccatggtggtggtttcttccgctacc |
12937945 |
T |
|
| Q |
212 |
acccttc |
218 |
Q |
| |
|
| ||||| |
|
|
| T |
12937944 |
atccttc |
12937938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University