View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5355_high_14 (Length: 314)
Name: NF5355_high_14
Description: NF5355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5355_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 11 - 298
Target Start/End: Original strand, 32958755 - 32959042
Alignment:
| Q |
11 |
cataggccaaactagcagtcagaacagcctgaaactaacactctaaaaccatgacaggaaaccaaacatgttgctcgacagaaattgtgacgcatctccc |
110 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958755 |
cataagccaaactagcagtcacaacagcctgaaactaacactctaaaaccatgacaggaaaccaaacatgttgctcgacagaaattgtgacgcatctccc |
32958854 |
T |
 |
| Q |
111 |
ccaaaatacgttgttgctgccttgtcacattccataaaacacaacaaatttgttaattaactatgtcatattttgtcagctactttatatttcaaacccg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32958855 |
ccaaaatacgttgttgctgccttgtcacattccataaaacacaacaaatttgttaattaactatgtcacattttgtcagctactttatatttcaaacccg |
32958954 |
T |
 |
| Q |
211 |
catcctctaccgttgttgcattagtggtaagaaccgttggggttagagaaaaagaaatgattctattttcaaatctcatggttcatac |
298 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
32958955 |
catcctctatcgttgttgcattagtggtaagaaccgttggggttagagaaaaagaaattattctattttcaaatctcacggttcatac |
32959042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 70 - 175
Target Start/End: Complemental strand, 49729865 - 49729760
Alignment:
| Q |
70 |
aaccaaacatgttgctcgacagaaattgtgacgcatctcccccaaaatacgttgttgctgccttgtcacattccataaaacacaacaaatttgttaatta |
169 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||| || |||| |||||||| ||||| ||| |||||||||||||||| ||| |
|
|
| T |
49729865 |
aaccaaacatgttgctcgatggaaattgtgacgcatctcccccaaaacacgccgtcgctgtcttgtcacgttccacaaagcacaacaaatttgttattta |
49729766 |
T |
 |
| Q |
170 |
actatg |
175 |
Q |
| |
|
| |||| |
|
|
| T |
49729765 |
attatg |
49729760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University