View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5355_high_25 (Length: 215)
Name: NF5355_high_25
Description: NF5355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5355_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 33495563 - 33495382
Alignment:
| Q |
15 |
cacagaggagaacaacatggacatgtaggaggagaacaccatggtgagtacaaaggagaacaacatggatttgtaggaggacatggtggtgagcacaaag |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33495563 |
cacaaaggagaacaacatggacatgtaggaggagaacaccacggtgagtacaaaggagaacaacatggatttgtaggaggacatggtggtgagcacaaag |
33495464 |
T |
 |
| Q |
115 |
gagagcaacatggatttggtcatggagaccacaaggaaggacaccatggagaagagcacaaggagggatttgttgacaagat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33495463 |
gagagcaacatggatttggtcatggagaccacaaggaaggacaccatggggaagagcacaaggagggatttgttgacaagat |
33495382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University