View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5355_low_18 (Length: 292)
Name: NF5355_low_18
Description: NF5355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5355_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 282
Target Start/End: Complemental strand, 28740642 - 28740374
Alignment:
| Q |
18 |
atattagatttatgctacatacaatgctttcagatacgcgtgtgcgtgtatacata----tgtcgataagttgtggcttagttaagctccagactatgtt |
113 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| ||||| ||| | |||||||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
28740642 |
atattagatttatgctacaaacaatgctttcagatacgtgtgtgtgtgtacacacacacatgtcgataagttgtggattaggtaagctccagattatgtt |
28740543 |
T |
 |
| Q |
114 |
tggataggtcagcccgtcaagtaaccttcatgacgattcgaacatatgcatatgtacagataataattgagaataagttaagttgtgtccttcgaggctc |
213 |
Q |
| |
|
||||||||||||||||||||| | ||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28740542 |
tggataggtcagcccgtcaaggatccttcgtgacgattcgaacatatgcatatggacaaataataattgagaataagttaagttgtgtccttcaaggctc |
28740443 |
T |
 |
| Q |
214 |
cagatcatgctggatgggatttcccctgcaagggaaatttacgcaagaacggttaagtcgtgtcctttg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
28740442 |
cagatcatgctggatgggatttcccctgcaagggaaatttacgcaagaacagttaagttgtgtcctttg |
28740374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 189 - 251
Target Start/End: Complemental strand, 28740392 - 28740331
Alignment:
| Q |
189 |
agttaagttgtgtccttcgaggctccagatcatgctggatgggatttcccctgcaagggaaat |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
28740392 |
agttaagttgtgtcctttgaggctccagattatgctggatgggatttcccc-gcaagggaaat |
28740331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 160
Target Start/End: Original strand, 20919853 - 20919940
Alignment:
| Q |
73 |
atgtcgataagttgtggcttagttaagctccagactatgtttggataggtcagcccgtcaagtaaccttcatgacgattcgaacatat |
160 |
Q |
| |
|
||||||| ||||||||||| || ||||| |||||||||||| |||||||||| ||| ||| | ||||||||||| || ||| |||||| |
|
|
| T |
20919853 |
atgtcgacaagttgtggctcaggtaagcaccagactatgttaggataggtcaacccatcagggaaccttcatgatgactcgtacatat |
20919940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 189 - 272
Target Start/End: Complemental strand, 12399089 - 12399008
Alignment:
| Q |
189 |
agttaagttgtgtccttcgaggctccagatcatgctggatgggatttcccctgcaagggaaatttacgcaagaacggttaagtc |
272 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||| |||||||||||||||| |||| |||||| ||| ||| ||| |||||||| |
|
|
| T |
12399089 |
agttaagttgtgtccatc-aggctccagattatgatggatgggatttcccc-gcaacggaaatctacacaataacagttaagtc |
12399008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University